WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030290 Gene Name  CBG08513
Sequence Name  ? CBG08513 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Multiheme cytochrome superfamily; Zinc-finger of C2H2 type; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans znf-236. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08513.1 CBG08513.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08513 CBG08513   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00136930
WBVar00136931

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG08513, AAGGAGTTCTTTGAGAAGAAGACGTTGGTGATTCATATGAGAATTCACACTGGAGAGCAG, WBGene00030290   Expr1062787 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term