WormMine: Gene WBGene00032787

• WormBase Gene ID: WBGene00032787
• Gene Name: CBG11703
• Sequence Name: CBG11703
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide repeat and Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans Y22D7AL.9.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11703.1	CBG11703.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11703	CBG11703		[unknown]

0 RNAi Result

19 Allele

• WBVar00137556
• WBVar00137553
• WBVar00137555
• WBVar00137554
• WBVar00117409
• WBVar00117408
• WBVar00117405
• WBVar00117404
• WBVar00117407
• WBVar00117406
• WBVar00117410
• WBVar00117401
• WBVar00117400
• WBVar00117403
• WBVar00117402
• WBVar00117397
• WBVar00117396
• WBVar00117399
• WBVar00117398

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055087
• Remark: CBG11703, GTGGAAATCGCTGAGAGATTTGCTGAAATTCGAAATTTCCAGAAAAATCGATAATTCTGG, WBGene00032787
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term