WormMine: Gene WBGene00039450

• WormBase Gene ID: WBGene00039450
• Gene Name: Cbr-ekl-1
• Sequence Name: CBG20475
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Tudor domain. Is an ortholog of C. elegans ekl-1. In C. elegans, ekl-1 is involved in P granule assembly and siRNA processing.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20475.1	CBG20475.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20475	CBG20475		[unknown]

0 RNAi Result

2 Allele

• WBVar00139267
• WBVar00139268

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061223
• Remark: Cbr-ekl-1, TGTGTGTGCTGTGAACGAGGAGAAAGCAAACTACACAGGCGAATGGCAGAGAGTACTGAT, WBGene00039450
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term