WormMine: Gene WBGene00038491

• WormBase Gene ID: WBGene00038491
• Gene Name: Cbr-glo-4
• Sequence Name: CBG19235
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Regulator of chromosome condensation (RCC1) repeat; Regulator of chromosome condensation, RCC1; and Regulator of chromosome condensation 1/beta-lactamase-inhibitor protein II. Is an ortholog of C. elegans glo-4. In C. elegans, glo-4 is involved in negative regulation of axon extension.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19235.1	CBG19235.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19235	CBG19235		[unknown]

0 RNAi Result

4 Allele

• WBVar00138938
• WBVar00138939
• WBVar00138940
• WBVar00138941

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063904
• Remark: Cbr-glo-4, AACATGGATGGTTCATGCTGGGGACAACGTTCTTTTCACAGTTTCAAATGAGAATGAGAT, WBGene00038491
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term