WormMine: Gene WBGene00025181

• WormBase Gene ID: WBGene00025181
• Gene Name: CBG02038
• Sequence Name: CBG02038
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Purine 5'-nucleotidase; HAD-like superfamily; HAD superfamily; HAD-superfamily hydrolase, subfamily IG, 5'-nucleotidase; and 5' nucleotidase family. Is an ortholog of C. elegans Y71H10B.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02038b.1	CBG02038b.1		[unknown]
Transcript:CBG02038a.1	CBG02038a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02038a	CBG02038a		[unknown]
CDS:CBG02038b	CBG02038b		[unknown]

0 RNAi Result

12 Allele

• WBVar00106941
• WBVar00106942
• WBVar00106940
• WBVar00106938
• WBVar00106939
• WBVar00106936
• WBVar00106937
• WBVar00106935
• WBVar00054249
• WBVar00022314
• WBVar00022319
• WBVar00022324

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063122
• Remark: CBG02038, GTTACAATCTGGTCCACTACCCATCGTTCTACTATTTCCGCGCTCCAATGAAGTGCATGC, WBGene00025181
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term