WormMine: Gene WBGene00270524

• WormBase Gene ID: WBGene00270524
• Gene Name: CBG30286
• Sequence Name: CBG30286
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Putative G-protein coupled receptor, Chromadorea. Is an ortholog of C. elegans B0244.4 and B0244.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30286c.1	CBG30286c.1		[unknown]
Transcript:CBG30286b.1	CBG30286b.1		[unknown]
Transcript:CBG30286a.1	CBG30286a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30286c	CBG30286c		[unknown]
CDS:CBG30286b	CBG30286b		[unknown]
CDS:CBG30286a	CBG30286a		[unknown]

0 RNAi Result

13 Allele

• WBVar00114405
• WBVar00114407
• WBVar00114406
• WBVar00114409
• WBVar00114408
• WBVar00114411
• WBVar00114410
• WBVar00114413
• WBVar00114412
• WBVar00114415
• WBVar00114414
• WBVar00114417
• WBVar00114416

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059032
• Remark: CBG09093, AATCACAACTTGTACTAACTTCTATCAAGCCGATCATTTGATAGTCCCTGCTATCATGAG, WBGene00030755
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term