WormMine: Gene WBGene00270642

• WormBase Gene ID: WBGene00270642
• Gene Name: CBG30588
• Sequence Name: CBG30588
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans F57G4.11.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG30588a.1	CBG30588a.1		[unknown]
Transcript:CBG30588b.1	CBG30588b.1		[unknown]
Transcript:CBG30588c.1	CBG30588c.1		[unknown]
Transcript:CBG30588d.1	CBG30588d.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG30588a	CBG30588a		[unknown]
CDS:CBG30588b	CBG30588b		[unknown]
CDS:CBG30588c	CBG30588c		[unknown]
CDS:CBG30588d	CBG30588d		[unknown]

0 RNAi Result

4 Allele

• WBVar00025502
• WBVar00025487
• WBVar00025492
• WBVar00025497

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059834
• Remark: CBG18613, TGGCCTCCTCTTCGATGGAACAATTCATATTCACGTATTACAAGATTTACGATGACCAAA, WBGene00037996
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term