WormMine: Gene WBGene00025697

• WormBase Gene ID: WBGene00025697
• Gene Name: Cbr-utp-20
• Sequence Name: CBG02688
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Down-regulated-in-metastasis protein; Armadillo-type fold; and Down-regulated in metastasis. Is an ortholog of C. elegans utp-20.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02688.1	CBG02688.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02688	CBG02688		[unknown]

0 RNAi Result

17 Allele

• WBVar00107583
• WBVar00107582
• WBVar00107581
• WBVar00107580
• WBVar00107586
• WBVar00107585
• WBVar00107584
• WBVar00107572
• WBVar00107571
• WBVar00107570
• WBVar00107579
• WBVar00107578
• WBVar00107577
• WBVar00107576
• WBVar00107575
• WBVar00107574
• WBVar00107573

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063828
• Remark: Cbr-tag-184, GGAAGAATACCGTACTCTGGTTGGATTCATTGCTGCTGCCTGTAGATATGAAATCAAGCA, WBGene00025697
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term