WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00026104 Gene Name  Cbr-agxt-1
Sequence Name  ? CBG03195 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Pyridoxal phosphate-dependent transferase, small domain; Pyridoxal phosphate-dependent transferase; Serine-pyruvate aminotransferase/2-aminoethylphosphonate-pyruvate transaminase; Aminotransferase class-V; Aminotransferase class V domain; and Pyridoxal phosphate-dependent transferase, major domain. Is an ortholog of C. elegans agxt-1. In C. elegans, agxt-1 is involved in glycine biosynthetic process, by transamination of glyoxylate. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG03195.1 CBG03195.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG03195 CBG03195   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00107308
WBVar00108145

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG03195, AAAAAATCCGGAATCGAAAACAACGCGTCGCCTCGTTCTACTTCGACGCATTGGAATTGG, WBGene00026104   Expr1067510 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term