WormMine: Gene WBGene00025254

• WormBase Gene ID: WBGene00025254
• Gene Name: CBG02150
• Sequence Name: CBG02150
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: SET domain.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02150.1	CBG02150.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02150	CBG02150		[unknown]

0 RNAi Result

21 Allele

• WBVar00107077
• WBVar00107079
• WBVar00107078
• WBVar00107088
• WBVar00107087
• WBVar00107086
• WBVar00107085
• WBVar00107084
• WBVar00107083
• WBVar00107082
• WBVar00107081
• WBVar00107089
• WBVar00107080
• WBVar00107097
• WBVar00107096
• WBVar00107095
• WBVar00107094
• WBVar00107093
• WBVar00107092
• WBVar00107091
• WBVar00107090

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068583
• Remark: CBG02150, GACAAAGGAACGAATGCGAAAAGGGCCTATGCTACAGATGCTTGGACCACGAGGATGATA, WBGene00025254
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term