WormMine: Gene WBGene00026513

• WormBase Gene ID: WBGene00026513
• Gene Name: Cbr-rba-1
• Sequence Name: CBG03711
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: G-protein beta WD-40 repeat; Histone-binding protein RBBP4, N-terminal; WD40/YVTN repeat-like-containing domain superfamily; Histone-binding protein RBBP4 or subunit C of CAF1 complex; WD40 repeat; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans rba-1. In C. elegans, rba-1 is involved in cell fate specification; nematode male tail tip morphogenesis; and regulation of neurogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03711.1	CBG03711.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03711	CBG03711		[unknown]

0 RNAi Result

2 Allele

• WBVar00108726
• WBVar00108725

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050550
• Remark: Cbr-rba-1, CAAATTCTTCTAAAATTTCTTCGTCTCCACCACCGGAAGTGTTGTTCGTTCATGCTGGAC, WBGene00026513
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term