WormMine: Gene WBGene00026471

• WormBase Gene ID: WBGene00026471
• Gene Name: CBG03659
• Sequence Name: CBG03659
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Ankyrin repeat domain-containing protein 13; Ankyrin repeat; GPCR-chaperone; Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans C01F1.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03659.1	CBG03659.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03659	CBG03659		[unknown]

0 RNAi Result

12 Allele

• WBVar00108679
• WBVar00108678
• WBVar00108683
• WBVar00108682
• WBVar00108681
• WBVar00108680
• WBVar00108689
• WBVar00108688
• WBVar00108687
• WBVar00108686
• WBVar00108685
• WBVar00108684

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated

1 Expression Patterns

• Primary Identifier: Expr1050964
• Remark: CBG03659, ATTTTCCAATAACATCCACGATAAACTATTCACAATTCCGACATCGTATCGCGAGGATCC, WBGene00026471
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term