WormMine: Gene WBGene00027587

• WormBase Gene ID: WBGene00027587
• Gene Name: Cbr-mom-1
• Sequence Name: CBG05032
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: MBOAT, membrane-bound O-acyltransferase family and Membrane bound O-acyl transferase, MBOAT. Is an ortholog of C. elegans mom-1. In C. elegans, mom-1 is involved in several processes, including Wnt signaling pathway, regulating spindle positioning; asymmetric protein localization involved in cell fate determination; and embryonic morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05032.1	CBG05032.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05032	CBG05032		[unknown]

0 RNAi Result

3 Allele

• WBVar00109840
• WBVar00109841
• WBVar00109839

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067198
• Remark: Cbr-mom-1, GGATCAAAAATCGTTGTCGCCAACCCGGTGAATATTGAGTTCTCGAGATCAACTTTGCAA, WBGene00027587
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term