WormMine: Gene WBGene00041896

• WormBase Gene ID: WBGene00041896
• Gene Name: CBG23571
• Sequence Name: CBG23571
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Histidine kinase/HSP90-like ATPase superfamily and Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase. Is an ortholog of C. elegans morc-1. In C. elegans, morc-1 is involved in DNA topological change.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG23571.1	CBG23571.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG23571	CBG23571		[unknown]

0 RNAi Result

9 Allele

• WBVar00033419
• WBVar00133118
• WBVar00033404
• WBVar00033409
• WBVar00133116
• WBVar00033414
• WBVar00133117
• WBVar00033399
• WBVar00133115

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053522
• Remark: CBG23571, TACGGTATCGAGGTCAATAACCGTCAATTTGACGATGGGATCCATTTGTATGTCAATAAT, WBGene00041896
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term