WormMine: Gene WBGene00035424

• WormBase Gene ID: WBGene00035424
• Gene Name: CBG15088
• Sequence Name: CBG15088
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: DNA/RNA polymerase superfamily. Is an ortholog of C. elegans Y26D4A.9 and ZC53.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15088.1	CBG15088.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15088	CBG15088		[unknown]

0 RNAi Result

42 Allele

• WBVar00044912
• WBVar00044917
• WBVar00044922
• WBVar00044927
• WBVar00044902
• WBVar00044907
• WBVar00044872
• WBVar00044877
• WBVar00044882
• WBVar00044887
• WBVar00044892
• WBVar00044897
• WBVar00044837
• WBVar00044832
• WBVar00044847
• WBVar00044842
• WBVar00044857
• WBVar00044852
• WBVar00044867
• WBVar00044862
• WBVar00044802
• WBVar00044807
• WBVar00044812
• WBVar00044817
• WBVar00044827
• WBVar00044822
• WBVar00044757
• WBVar00044752
• WBVar00044762
• WBVar00044767

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1056660
• Remark: CBG15088, AATAAGGTTATGTTACCAGGATACTGATAGTTTAATTTATGAAATTGAAACAGAAAATGT, WBGene00035424
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term