WormMine: Gene WBGene00028447

• WormBase Gene ID: WBGene00028447
• Gene Name: Cbr-mig-38
• Sequence Name: CBG06120
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: GLTSCR protein, conserved region and Conserved region of unknown function on GLTSCR protein. Is an ortholog of C. elegans mig-38.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06120a.1	CBG06120a.1		[unknown]
Transcript:CBG06120b.3	CBG06120b.3		[unknown]
Transcript:CBG06120b.1	CBG06120b.1		[unknown]
Transcript:CBG06120b.2	CBG06120b.2		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06120b	CBG06120b		[unknown]
CDS:CBG06120a	CBG06120a		[unknown]

0 RNAi Result

1 Allele

• WBVar00044942

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050498
• Remark: CBG06120, TGAAAAGCAAACTGAAAAAACCGGTCAACGGAGCCGCGCCTATTCTTCCCTGGTCAACTG, WBGene00028447
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term