WormMine: Gene WBGene00029473

• WormBase Gene ID: WBGene00029473
• Gene Name: Cbr-unc-84
• Sequence Name: CBG07416
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SUN domain; Galactose-binding-like domain superfamily; and Sad1 / UNC-like C-terminal. Is an ortholog of C. elegans unc-84. In C. elegans, unc-84 is involved in several processes, including egg-laying behavior; nuclear migration along microtubule; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07416.1	CBG07416.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07416	CBG07416		[unknown]

0 RNAi Result

19 Allele

• WBVar00045769
• WBVar00045774
• WBVar00045779
• WBVar00045784
• WBVar00045789
• WBVar00045794
• WBVar00112301
• WBVar00112300
• WBVar00112291
• WBVar00112290
• WBVar00112295
• WBVar00112294
• WBVar00112293
• WBVar00112292
• WBVar00112299
• WBVar00112298
• WBVar00112297
• WBVar00112296
• sy5506

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066689
• Remark: Cbr-unc-84, ACATTGCAGTAGAGCTGTCGCATTTCATTGATGTATCCAGTATTAGCTACGAACACATTG, WBGene00029473
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term