WormMine: Gene WBGene00039949

• WormBase Gene ID: WBGene00039949
• Gene Name: CBG21079
• Sequence Name: CBG21079
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein kinase-like domain superfamily; CHK kinase-like; Uncharacterized oxidoreductase dhs-27; and Uncharacterised oxidoreductase Dhs-27. Is an ortholog of C. elegans F49C12.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG21079.1	CBG21079.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG21079	CBG21079		[unknown]

0 RNAi Result

1 Allele

• WBVar00045082

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064169
• Remark: CBG21079, ATTGGTTCCTCCAGCTCAACAACACTCTAATGGCTCATTTTCCGGATGAGGAAATGCAAA, WBGene00039949
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term