WormMine: Gene WBGene00034480

• WormBase Gene ID: WBGene00034480
• Gene Name: CBG13771
• Sequence Name: CBG13771
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Selenoprotein SelK/SelG and Selenoprotein SelK_SelG. Is an ortholog of C. elegans Y41E3.8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13771.1	CBG13771.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13771	CBG13771		[unknown]

0 RNAi Result

26 Allele

• WBVar00046619
• WBVar00017024
• WBVar00017019
• WBVar00017014
• WBVar00017009
• WBVar00017004
• WBVar00017044
• WBVar00017049
• WBVar00017034
• WBVar00017039
• WBVar00017029
• WBVar00120315
• WBVar00120316
• WBVar00120317
• WBVar00120318
• WBVar00120319
• WBVar00120320
• WBVar00120321
• WBVar00120322
• WBVar00120323
• WBVar00120324
• WBVar00016999
• WBVar00016994
• WBVar00016989
• WBVar00016984
• WBVar00016979

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063291
• Remark: CBG13771, CAAAATCGTAACAGCAACCATCAGGACTACCGTAATATCGTCCGAGGGGGCGGAGTCAAC, WBGene00034480
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term