WormMine: Gene WBGene00034467

• WormBase Gene ID: WBGene00034467
• Gene Name: CBG13756
• Sequence Name: CBG13756
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: 7TM GPCR, serpentine receptor class r (Str) and Serpentine type 7TM GPCR chemoreceptor Str.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13756.1	CBG13756.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13756	CBG13756		[unknown]

0 RNAi Result

12 Allele

• WBVar00046539
• WBVar00046534
• WBVar00046544
• WBVar00046549
• WBVar00046554
• WBVar00046519
• WBVar00046529
• WBVar00046524
• WBVar00120304
• WBVar00120305
• WBVar00120306
• WBVar00120307

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1057340
• Remark: CBG13756, AACTCATTATACTCTACTTTTGAATTACCTCTCAACTCCACAATCTACTATGCTCGTATG, WBGene00034467
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term