WormMine: Gene WBGene00024465

• WormBase Gene ID: WBGene00024465
• Gene Name: CBG01197
• Sequence Name: CBG01197
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Venom allergen 5-like; CAP superfamily; Cysteine-rich secretory protein family; CAP domain; and Cysteine-rich secretory protein-related. Is an ortholog of C. elegans scl-12 and scl-13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01197.1	CBG01197.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01197	CBG01197		[unknown]

0 RNAi Result

4 Allele

• WBVar00033804
• WBVar00033809
• WBVar00033814
• WBVar00033799

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1059480
• Remark: CBG01197, CAAAGGACCCGTCTCATAACGACATGTTCAAGTATGTTGTGGTGTGCCATTATAAGGAAC, WBGene00024465
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term