WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036036 Gene Name  CBG15935
Sequence Name  ? CBG15935 Organism  Caenorhabditis briggsae
Automated Description  Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Glutaredoxin; Glutaredoxin subgroup; Glutaredoxin, eukaryotic/virial; and Thioredoxin-like superfamily. Is an ortholog of C. elegans F10D7.3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG15935a.1 CBG15935a.1   [unknown]
Transcript:CBG15935b.1 CBG15935b.1   [unknown]
Transcript:CBG15935c.1 CBG15935c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG15935c CBG15935c   [unknown]
CDS:CBG15935b CBG15935b   [unknown]
CDS:CBG15935a CBG15935a   [unknown]

0 RNAi Result

2 Allele

Public Name
WBVar00049984
WBVar00123454

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16. DESeq2, FDR < 0.05. WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Heat shock: 34C 30min. Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG15935, AAAGTTTGTGGGTGGACATGACGAAACAAAGGCTATCGAGGAGAAAGGAGAGCTTCGACC, WBGene00036036   Expr1052631 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term