WormMine: Gene WBGene00036973

• WormBase Gene ID: WBGene00036973
• Gene Name: Cbr-selt-1.1
• Sequence Name: CBG17303
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Rdx family; Selenoprotein T; Selenoprotein, Rdx-type; and Thioredoxin-like superfamily. Is an ortholog of C. elegans selt-1.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17303.1	CBG17303.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17303	CBG17303		[unknown]

0 RNAi Result

12 Allele

• WBVar00049774
• WBVar00049769
• WBVar00049784
• WBVar00049779
• WBVar00049794
• WBVar00049789
• WBVar00049739
• WBVar00049744
• WBVar00049749
• WBVar00049764
• WBVar00049754
• WBVar00049759

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1054396
• Remark: CBG17303, GCCATCTCCACAGGAATTCATGCAATTGATTGACGCGCAACTTGCCGTGCTCGGAAAAGC, WBGene00036973
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term