WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00038377 Gene Name  Cbr-kxd-1
Sequence Name  ? CBG19105 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: KxDL motif-containing protein 1-like; Uncharacterised domain KxDL; and Uncharacterized conserved protein. Is an ortholog of C. elegans kxd-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG19105.1 CBG19105.1   [unknown]
Transcript:CBG19105.2 CBG19105.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG19105 CBG19105   [unknown]

0 RNAi Result

2 Allele

Public Name
cbp40282
cbp40283

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG19107, TACTGGTGGTTGGGAATCTCATCTACACAAGTTTCACTGACAGAATCGTTTTGAAATCAA, WBGene00038379   Expr1057863 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG19105, GGGGGACCGTCGAATCGAGAAAGCGAAAAAGGATTCGATAGGACACAAGGATACGATTCT, WBGene00038377   Expr1051624 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term