WormMine: Gene WBGene00025333

• WormBase Gene ID: WBGene00025333
• Gene Name: Cbr-ubc-25
• Sequence Name: CBG02252
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ubiquitin-conjugating enzyme; Ubiquitin-conjugating enzyme E2; and Ubiquitin-conjugating enzyme/RWD-like. Is an ortholog of C. elegans ubc-25. In C. elegans, ubc-25 is involved in locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02252.1	CBG02252.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02252	CBG02252		[unknown]

0 RNAi Result

1 Allele

• WBVar00001734

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062912
• Remark: Cbr-ubc-25, ACGAAGCAAGGATGGTCATCAGCGTATTCGATTGAGAGTTGTATTCTTCAAATCGCAGCC, WBGene00025333
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term