WormMine: Gene WBGene00032289

• WormBase Gene ID: WBGene00032289
• Gene Name: Cbr-exl-1
• Sequence Name: CBG11108
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Glutathione S-transferase, C-terminal domain superfamily and Thioredoxin-like superfamily. Is an ortholog of C. elegans exl-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11108.1	CBG11108.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11108	CBG11108		[unknown]

0 RNAi Result

9 Allele

• WBVar00001584
• WBVar00116543
• WBVar00116544
• WBVar00116545
• WBVar00116546
• WBVar00116547
• WBVar00116548
• WBVar00116549
• WBVar00116550

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052777
• Remark: Cbr-exl-1, AAAAACTACGAATTCCCGCCGGATTTGACGCATCTTTGGGACTATTTGAAGTCTGGTTAC, WBGene00032289
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term