WormMine: Gene WBGene00038920

• WormBase Gene ID: WBGene00038920
• Gene Name: CBG19750
• Sequence Name: CBG19750
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Polysaccharide biosynthesis; Polysaccharide biosynthesis domain; Protein PBDC1, metazoa/fungi; and PBDC1-like domain superfamily. Is an ortholog of C. elegans Y54E5A.5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19750.2	CBG19750.2		[unknown]
Transcript:CBG19750.1	CBG19750.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19750	CBG19750		[unknown]

0 RNAi Result

2 Allele

• WBVar00001199
• WBVar00028344

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068907
• Remark: CBG19750, GGAGATGGCGAGAAACGTGGAAGGTGTCAATGAGAAGAACAAGGCCTCCTATACGGCAAG, WBGene00038920
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term