WormMine: Gene WBGene00026480

• WormBase Gene ID: WBGene00026480
• Gene Name: Cbr-mog-2
• Sequence Name: CBG03669
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Leucine-rich repeat and Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans mog-2. In C. elegans, mog-2 is involved in feminization of hermaphroditic germ-line; germline cell cycle switching, mitotic to meiotic cell cycle; and mRNA 3'-splice site recognition.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03669.1	CBG03669.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03669	CBG03669		[unknown]

0 RNAi Result

6 Allele

• WBVar00001052
• WBVar00001047
• WBVar00001067
• WBVar00001062
• WBVar00001057
• WBVar00001042

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063780
• Remark: Cbr-sap-1, AAATGCCAAATCCCTCTCTGAAGTCAACTATCTTCAGTCGATTCTGGCTTCTGGAAAGAT, WBGene00026480
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term