WormMine: Gene WBGene00034831

• WormBase Gene ID: WBGene00034831
• Gene Name: Cbr-aex-4
• Sequence Name: CBG14277
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Target SNARE coiled-coil homology domain. Is an ortholog of C. elegans aex-4. In C. elegans, aex-4 is involved in positive regulation of defecation and positive regulation of protein secretion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14277.1	CBG14277.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14277	CBG14277		[unknown]

0 RNAi Result

18 Allele

• WBVar00002329
• WBVar00002334
• WBVar00121190
• WBVar00121191
• WBVar00121192
• WBVar00121188
• WBVar00121189
• WBVar00121181
• WBVar00121182
• WBVar00121183
• WBVar00121184
• WBVar00121185
• WBVar00121186
• WBVar00121187
• WBVar00029344
• WBVar00029349
• WBVar00029354
• WBVar00029359

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Heat shock: 34C 30min.	Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min.	DESeq2 v 1.18.1, fold change > 2, FDR < 0.01.	WBPaper00058955:heatshock_upregulated_CBG

1 Expression Patterns

• Primary Identifier: Expr1066746
• Remark: Cbr-aex-4, ATGCGACACAATCGAAGACGAATTAGAGCGTAATCTGATGCAAATCGATCAAGGGCTTGA, WBGene00034831
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term