Genomics
1 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:CBG14277.1 | CBG14277.1 | [unknown] |
Other
18 Allele
Public Name |
---|
WBVar00002329 |
WBVar00002334 |
WBVar00121190 |
WBVar00121191 |
WBVar00121192 |
WBVar00121188 |
WBVar00121189 |
WBVar00121181 |
WBVar00121182 |
WBVar00121183 |
WBVar00121184 |
WBVar00121185 |
WBVar00121186 |
WBVar00121187 |
WBVar00029344 |
WBVar00029349 |
WBVar00029354 |
WBVar00029359 |
1 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Heat shock: 34C 30min. | Transcripts that showed significantly increased expression in L2 larva stage C. briggsae animals after incubated in a 34C water bath for 30min. | DESeq2 v 1.18.1, fold change > 2, FDR < 0.01. | WBPaper00058955:heatshock_upregulated_CBG |
1 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Cbr-aex-4, ATGCGACACAATCGAAGACGAATTAGAGCGTAATCTGATGCAAATCGATCAAGGGCTTGA, WBGene00034831 | Expr1066746 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 |