WormMine: Gene WBGene00039605

• WormBase Gene ID: WBGene00039605
• Gene Name: CBG20667
• Sequence Name: CBG20667
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Six-bladed beta-propeller, TolB-like; WD40-like Beta Propeller Repeat; and WD40-like beta propeller. Is an ortholog of C. elegans tag-10.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20667.1	CBG20667.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20667	CBG20667		[unknown]

0 RNAi Result

1 Allele

• WBVar00003844

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069602
• Remark: Cbr-tag-10, TGCCATGCAAAGTTACGATGGAAAGAAATTGGTTTGGGGATCGAGTCGGAATGGAACACA, WBGene00039605
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term