WormMine: Gene WBGene00025160

• WormBase Gene ID: WBGene00025160
• Gene Name: Cbr-osm-5
• Sequence Name: CBG02013
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Tetratricopeptide repeat and Tetratricopeptide-like helical domain superfamily. Is an ortholog of C. elegans osm-5. In C. elegans, osm-5 is involved in several processes, including dauer entry; locomotory exploration behavior; and non-motile cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG02013.1	CBG02013.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG02013	CBG02013		[unknown]

0 RNAi Result

3 Allele

• WBVar00141652
• WBVar00141653
• WBVar00141651

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061866
• Remark: Cbr-osm-5, CGGTATGACAAACCGCCCAAAAACTGGATCTCGAAAAACTGTCACTGAACTTAGTCCTGA, WBGene00025160
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term