WormMine: Gene WBGene00024304

• WormBase Gene ID: WBGene00024304
• Gene Name: Cbr-egl-43
• Sequence Name: CBG01007
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2 superfamily; and Zinc finger C2H2-type. Is an ortholog of C. elegans egl-43. In C. elegans, egl-43 is involved in several processes, including regulation of developmental process; regulation of mitotic cell cycle; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01007b.1	CBG01007b.1		[unknown]
Transcript:CBG01007a.1	CBG01007a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01007b	CBG01007b		[unknown]
CDS:CBG01007a	CBG01007a		[unknown]

0 RNAi Result

15 Allele

• WBVar00141517
• WBVar00141518
• WBVar00141519
• WBVar00141514
• WBVar00141515
• WBVar00141516
• WBVar00141520
• WBVar00141521
• WBVar00141522
• WBVar00066141
• WBVar00066146
• WBVar00066151
• WBVar00066126
• WBVar00066131
• WBVar00066136

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1051759
• Remark: Cbr-egl-43, GTTCTGTCAGAAGGTTTTCCCAAGATCTGCCAATTTAACCCGGCATTTGAGAACACATAC, WBGene00024304
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term