WormMine: Gene WBGene00024762

• WormBase Gene ID: WBGene00024762
• Gene Name: Cbr-sax-7
• Sequence Name: CBG01538
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin subtype; Fibronectin type III domain; Neurofascin/L1/NrCAM, C-terminal domain; Immunoglobulin I-set; Immunoglobulin subtype 2; Fibronectin type III; Fibronectin type III superfamily; Immunoglobulin I-set domain; Bravo-like intracellular region; Immunoglobulin domain; Immunoglobulin-like fold; and Immunoglobulin-like domain superfamily. Is an ortholog of C. elegans sax-7. In C. elegans, sax-7 is involved in several processes, including cell development; establishment of mitotic spindle orientation; and regulation of cell morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01538a.1	CBG01538a.1		[unknown]
Transcript:CBG01538b.1	CBG01538b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01538a	CBG01538a		[unknown]
CDS:CBG01538b	CBG01538b		[unknown]

0 RNAi Result

8 Allele

• WBVar00141587
• WBVar00141588
• WBVar00037444
• WBVar00037449
• WBVar00037454
• WBVar00009224
• WBVar00009229
• WBVar00068646

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065681
• Remark: Cbr-sax-7, AATCAGAATCACTGGATTGGAAAATGAGACGCCGTACAGATTCATTCTGAGAGCTCACAC, WBGene00024762
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term