WormMine: Gene WBGene00027733

• WormBase Gene ID: WBGene00027733
• Gene Name: CBG05224
• Sequence Name: CBG05224
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Protein of unknown function (DUF229); Alkaline-phosphatase-like, core domain superfamily; and Protein of unknown function DUF229. Is an ortholog of C. elegans K03A11.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05224.1	CBG05224.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05224	CBG05224		[unknown]

0 RNAi Result

30 Allele

• WBVar00004867
• WBVar00004872
• WBVar00004862
• WBVar00004877
• WBVar00004882
• WBVar00050872
• WBVar00050877
• WBVar00050847
• WBVar00050842
• WBVar00050832
• WBVar00050837
• WBVar00050867
• WBVar00050862
• WBVar00050857
• WBVar00050852
• WBVar00050802
• WBVar00050807
• WBVar00050822
• WBVar00050827
• WBVar00050812
• WBVar00050817
• WBVar00050762
• WBVar00050757
• WBVar00050752
• WBVar00050782
• WBVar00050787
• WBVar00050777
• WBVar00050747
• WBVar00050742
• WBVar00050737

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068060
• Remark: CBG05224, GGGTATGGTGGAACGGAGTAACAGATATGGCAAGACTGCTGATTGCATAAAGTCGGAGTA, WBGene00027733
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term