WormMine: Gene WBGene00037198

• WormBase Gene ID: WBGene00037198
• Gene Name: Cbr-miz-1
• Sequence Name: CBG17627
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zmiz1, N-terminal tetratricopeptide repeat domain; Zinc finger, RING/FYVE/PHD-type; and Zmiz1 N-terminal tetratricopeptide repeat domain. Is an ortholog of C. elegans miz-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG17627a.1	CBG17627a.1		[unknown]
Transcript:CBG17627b.1	CBG17627b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG17627a	CBG17627a		[unknown]
CDS:CBG17627b	CBG17627b		[unknown]

0 RNAi Result

12 Allele

• WBVar00004394
• WBVar00004399
• WBVar00004404
• WBVar00125640
• WBVar00125634
• WBVar00125635
• WBVar00125632
• WBVar00125633
• WBVar00125638
• WBVar00125639
• WBVar00125636
• WBVar00125637

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1060653
• Remark: CBG17627, GATCCGCTCCATACACTCCGGAATCAGTGAAAAATGATAAGAACGATGAGTTGTTGATGA, WBGene00037198
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term