WormMine: Gene WBGene00023858

• WormBase Gene ID: WBGene00023858
• Gene Name: CBG00478
• Sequence Name: CBG00478
• Organism: Caenorhabditis briggsae
• Automated Description: Is affected by Cbr-spr-4 based on RNA-seq studies. Is predicted to encode a protein with the following domains: Protein of unknown function DUF272 and Protein of unknown function (DUF272).
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG00478.1	CBG00478.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG00478	CBG00478		[unknown]

0 RNAi Result

23 Allele

• WBVar00141296
• WBVar00141297
• WBVar00141298
• WBVar00141278
• WBVar00141279
• WBVar00141276
• WBVar00141277
• WBVar00141281
• WBVar00141282
• WBVar00141283
• WBVar00141284
• WBVar00141280
• WBVar00141289
• WBVar00141285
• WBVar00141286
• WBVar00141287
• WBVar00141288
• WBVar00141292
• WBVar00141293
• WBVar00141294
• WBVar00141295
• WBVar00141290
• WBVar00141291

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_upregulated
Virus infection: Santeuil infected at L3 larva stage for 12 hours.	Transcripts that showed signicantly increased expression after Santeuil virus infection to C. briggsae strain JU1264.	edgeR, FDR < 0.05.	WBPaper00051137:Santeuil-virus_upregulated_JU1264

1 Expression Patterns

• Primary Identifier: Expr1062550
• Remark: CBG00478, GAACCCAGAAAAGCCCATAAAAATGGGAGATTGGGTGAATTTGAAATTCACGTCTTCTGA, WBGene00023858
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term