WormMine: Gene WBGene00027915

• WormBase Gene ID: WBGene00027915
• Gene Name: Cbr-lsm-8
• Sequence Name: CBG05470
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: LSM domain superfamily; LSM domain, eukaryotic/archaea-type; and LSM domain. Is an ortholog of C. elegans lsm-8.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG05470.1	CBG05470.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG05470	CBG05470		[unknown]

0 RNAi Result

4 Allele

• WBVar00110623
• WBVar00110622
• WBVar00015354
• WBVar00015359

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061018
• Remark: Cbr-lsm-8, CATTGGTGAAATCGACGAGGAACTCGACAAACGCGTCGATCTAGAGAATGTGAAGGCAGC, WBGene00027915
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term