WormMine: Gene WBGene00029322

• WormBase Gene ID: WBGene00029322
• Gene Name: Cbr-cogc-4
• Sequence Name: CBG07185
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Conserved oligomeric Golgi complex, subunit 4 and COG4 transport protein. Is an ortholog of C. elegans cogc-4. In C. elegans, cogc-4 is involved in gonad morphogenesis and regulation of cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07185.1	CBG07185.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07185	CBG07185		[unknown]

0 RNAi Result

19 Allele

• WBVar00112058
• WBVar00112059
• WBVar00112060
• WBVar00112049
• WBVar00112048
• WBVar00112052
• WBVar00112053
• WBVar00112050
• WBVar00112051
• WBVar00112056
• WBVar00112057
• WBVar00112054
• WBVar00112055
• WBVar00017374
• WBVar00017379
• WBVar00017384
• WBVar00017389
• WBVar00017394
• WBVar00017369

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1068761
• Remark: Cbr-cogc-4, AAATGCCAGTTTAATCGATATGGAGCACTTCAGTTGGATCGGGAGTACCGACAGATATGC, WBGene00029322
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term