WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00033309 Gene Name  Cbr-cle-1
Sequence Name  ? CBG12347 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: C-type lectin fold; Laminin G domain; Collagen triple helix repeat (20 copies); Collagenase NC10/endostatin; Collagen triple helix repeat; C-type lectin-like/link domain superfamily; Concanavalin A-like lectin/glucanase domain superfamily; and Collagenase NC10 and Endostatin. Is an ortholog of C. elegans cle-1. In C. elegans, cle-1 is involved in several processes, including cholinergic synaptic transmission; generation of neurons; and inductive cell migration. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

11 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG12347g.1 CBG12347g.1   [unknown]
Transcript:CBG12347h.1 CBG12347h.1   [unknown]
Transcript:CBG12347e.1 CBG12347e.1   [unknown]
Transcript:CBG12347f.1 CBG12347f.1   [unknown]
Transcript:CBG12347k.1 CBG12347k.1   [unknown]
Transcript:CBG12347i.1 CBG12347i.1   [unknown]
Transcript:CBG12347j.1 CBG12347j.1   [unknown]
Transcript:CBG12347c.1 CBG12347c.1   [unknown]
Transcript:CBG12347d.1 CBG12347d.1   [unknown]
Transcript:CBG12347a.1 CBG12347a.1   [unknown]
Transcript:CBG12347b.1 CBG12347b.1   [unknown]
 

Other

11 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG12347c CBG12347c   [unknown]
CDS:CBG12347d CBG12347d   [unknown]
CDS:CBG12347a CBG12347a   [unknown]
CDS:CBG12347b CBG12347b   [unknown]
CDS:CBG12347g CBG12347g   [unknown]
CDS:CBG12347h CBG12347h   [unknown]
CDS:CBG12347e CBG12347e   [unknown]
CDS:CBG12347f CBG12347f   [unknown]
CDS:CBG12347k CBG12347k   [unknown]
CDS:CBG12347i CBG12347i   [unknown]
CDS:CBG12347j CBG12347j   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00008914

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-cle-1, CATGTCCAAATATCACAGCGATCGAATTCTCCGTCTCAACAGAATCACCACCGACTTCAA, WBGene00033309   Expr1055140 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term