WormMine: Gene WBGene00033536

• WormBase Gene ID: WBGene00033536
• Gene Name: CBG12618
• Sequence Name: CBG12618
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: VAD1 Analog of StAR-related lipid transfer domain; Membrane-anchored lipid-binding protein Ysp2/Lam4-like; and VASt domain. Is an ortholog of C. elegans ZC328.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG12618b.1	CBG12618b.1		[unknown]
Transcript:CBG12618a.1	CBG12618a.1		[unknown]
Transcript:CBG12618c.1	CBG12618c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG12618c	CBG12618c		[unknown]
CDS:CBG12618b	CBG12618b		[unknown]
CDS:CBG12618a	CBG12618a		[unknown]

0 RNAi Result

15 Allele

• WBVar00008879
• WBVar00118718
• WBVar00118717
• WBVar00118719
• WBVar00118716
• WBVar00118721
• WBVar00118720
• WBVar00118723
• WBVar00118722
• WBVar00118729
• WBVar00118728
• WBVar00118725
• WBVar00118724
• WBVar00118727
• WBVar00118726

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055529
• Remark: CBG12618, GTATGGGGTGTTGTGAAGAACTTCATCGAGAAACCAACCTACAGTGCATTGGAGGAACAT, WBGene00033536
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term