WormMine: Gene WBGene00029690

• WormBase Gene ID: WBGene00029690
• Gene Name: Cbr-erv-46
• Sequence Name: CBG07736
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Endoplasmic reticulum vesicle transporter, C-terminal; Endoplasmic reticulum vesicle transporter; Endoplasmic reticulum vesicle transporter, N-terminal; and Endoplasmic Reticulum-Golgi Intermediate Compartment (ERGIC). Is an ortholog of C. elegans ergi-3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07736.1	CBG07736.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07736	CBG07736		[unknown]

0 RNAi Result

10 Allele

• WBVar00008702
• WBVar00008707
• WBVar00008712
• WBVar00008692
• WBVar00008697
• WBVar00008682
• WBVar00008687
• WBVar00019754
• WBVar00019744
• WBVar00019749

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067668
• Remark: Cbr-erv-46, CTCAACTTGTAGACATCACGATTTATCACACATCACGCTACATGAAAAGCCGTATCGCTG, WBGene00029690
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term