WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029672 Gene Name  Cbr-exc-1
Sequence Name  ? CBG07708 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: P-loop containing nucleoside triphosphate hydrolase. Is an ortholog of C. elegans exc-1. In C. elegans, exc-1 is involved in epithelial cell development and regulation of tube size. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

5 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG07708.3 CBG07708.3   [unknown]
Transcript:CBG07708.2 CBG07708.2   [unknown]
Transcript:CBG07708.5 CBG07708.5   [unknown]
Transcript:CBG07708.4 CBG07708.4   [unknown]
Transcript:CBG07708.1 CBG07708.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG07708 CBG07708   [unknown]

0 RNAi Result

3 Allele

Public Name
WBVar00008637
WBVar00008627
WBVar00008632

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG07708, GCAGCAGAATTACGTGGAAGAGTTAATGTATTCTTCGTTTCGGCTCCGGTGTTCAAAGCT, WBGene00029672   Expr1060907 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term