WormMine: Gene WBGene00029561

• WormBase Gene ID: WBGene00029561
• Gene Name: Cbr-rbc-1
• Sequence Name: CBG07562
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: RAVE protein 1 C terminal; WD40/YVTN repeat-like-containing domain superfamily; WD40 repeat; RAVE complex protein Rav1 C-terminal; WD domain, G-beta repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans rbc-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07562b.1	CBG07562b.1		[unknown]
Transcript:CBG07562a.1	CBG07562a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07562b	CBG07562b		[unknown]
CDS:CBG07562a	CBG07562a		[unknown]

0 RNAi Result

2 Allele

• WBVar00008307
• WBVar00008302

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065497
• Remark: Cbr-rbc-1, GCCAATCGTCTGTCCAAGGAGTCCAACAACTTTTCATCGATCAAAACATGCGCCTCTTCT, WBGene00029561
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term