WormMine: Gene WBGene00029572

• WormBase Gene ID: WBGene00029572
• Gene Name: CBG07576
• Sequence Name: CBG07576
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Organic solute transporter Ostalpha and Organic solute transporter subunit alpha/Transmembrane protein 184. Is an ortholog of C. elegans F40E10.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07576.1	CBG07576.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07576	CBG07576		[unknown]

0 RNAi Result

2 Allele

• WBVar00008332
• WBVar00008337

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067165
• Remark: CBG07576, GCCAACGATGGACGTCCAGTCACACTTCAATCCATAAGCTCGTCGCTCAAAGAAACTATG, WBGene00029572
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term