WormMine: Gene WBGene00035694

• WormBase Gene ID: WBGene00035694
• Gene Name: Cbr-jbts-14
• Sequence Name: CBG15417
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: Transmembrane protein 237. Is an ortholog of C. elegans jbts-14. In C. elegans, jbts-14 is involved in non-motile cilium assembly.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG15417.1	CBG15417.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG15417	CBG15417		[unknown]

0 RNAi Result

4 Allele

• WBVar00008054
• WBVar00008044
• WBVar00008049
• WBVar00122398

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058477
• Remark: CBG15417, AATCTACAGCGTATTCAGAGCGGTTACTGCTGCACTTGGCTTTTTAATTCTGGCATTCAA, WBGene00035694
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term