WormMine: Gene WBGene00028426

• WormBase Gene ID: WBGene00028426
• Gene Name: CBG06095
• Sequence Name: CBG06095
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Ankyrin repeat; Ankyrin repeats (many copies); Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; and Ankyrin repeats (3 copies). Is an ortholog of C. elegans ZK792.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG06095.1	CBG06095.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG06095	CBG06095		[unknown]

0 RNAi Result

9 Allele

• WBVar00111235
• WBVar00111236
• WBVar00111234
• WBVar00111239
• WBVar00111237
• WBVar00111238
• WBVar00111242
• WBVar00111240
• WBVar00111241

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1066104
• Remark: CBG06095, CAGATATGGATCTTCTCCAATCTCACGTCAAAGTACTTGATGACAAAACTTGGGCAGGTC, WBGene00028426
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term