WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00029993 Gene Name  Cbr-ifc-2
Sequence Name  ? CBG08136 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Intermediate filament protein; Lamin tail domain superfamily; and Intermediate filament, rod domain. Is an ortholog of C. elegans ifc-2. In C. elegans, ifc-2 is involved in post-embryonic digestive tract morphogenesis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08136b.1 CBG08136b.1   [unknown]
Transcript:CBG08136c.1 CBG08136c.1   [unknown]
Transcript:CBG08136a.1 CBG08136a.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08136a CBG08136a   [unknown]
CDS:CBG08136c CBG08136c   [unknown]
CDS:CBG08136b CBG08136b   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00009807

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-ifc-2, CTCCGTGAGCAATGTACCGAACTTAGCATCCAAATGGAGAGGCTATGCGACAACGAAATC, WBGene00029993   Expr1063169 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG27390, GTCACATCTGCTCATGTTTTCACAATGTCCACTCCTCAATTGTATCCTCAAACCAGGAAA, WBGene00088804   Expr1062987 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term