WormMine: Gene WBGene00029680

• WormBase Gene ID: WBGene00029680
• Gene Name: Cbr-olrn-1
• Sequence Name: CBG07722
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Nucleoside 2-deoxyribosyltransferase-like and Nucleoside 2-deoxyribosyltransferase like. Is an ortholog of C. elegans olrn-1. In C. elegans, olrn-1 is involved in olfactory learning.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG07722a.1	CBG07722a.1		[unknown]
Transcript:CBG07722b.1	CBG07722b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG07722a	CBG07722a		[unknown]
CDS:CBG07722b	CBG07722b		[unknown]

0 RNAi Result

15 Allele

• WBVar00112765
• WBVar00112764
• WBVar00112763
• WBVar00112762
• WBVar00112768
• WBVar00112767
• WBVar00112766
• WBVar00112758
• WBVar00112757
• WBVar00112756
• WBVar00112755
• WBVar00112759
• WBVar00112761
• WBVar00112760
• WBVar00050619

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1067360
• Remark: Cbr-olrn-1, CCATCACCACAAGAAATTCTTCTACTACATTCCATCAACAACCACCTTCCTCTCAGGAAT, WBGene00029680
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term