WormMine: Gene WBGene00030845

• WormBase Gene ID: WBGene00030845
• Gene Name: Cbr-lin-48
• Sequence Name: CBG09216
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Ovo-like; Zinc finger C2H2-type; and Zinc finger C2H2 superfamily. Is an ortholog of C. elegans lin-48. In C. elegans, lin-48 is involved in anatomical structure morphogenesis and response to salt stress.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG09216.1	CBG09216.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG09216	CBG09216		[unknown]

0 RNAi Result

8 Allele

• WBVar00114668
• WBVar00114667
• WBVar00114666
• WBVar00114665
• WBVar00114669
• WBVar00114671
• WBVar00114670
• WBVar00028724

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1055999
• Remark: Cbr-lin-48, AAATTTGAAGTTTACCTGTCCCACATAAAGGCGGTCCATCCACTTTCAGCAGCTTATTTC, WBGene00030845
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term