WormMine: Gene WBGene00030266

• WormBase Gene ID: WBGene00030266
• Gene Name: Cbr-grh-1
• Sequence Name: CBG08484
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: CP2 transcription factor. Is an ortholog of C. elegans grh-1. In C. elegans, grh-1 is involved in defense response to bacterium; determination of adult lifespan; and ecdysis, collagen and cuticulin-based cuticle.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG08484a.1	CBG08484a.1		[unknown]
Transcript:CBG08484b.1	CBG08484b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG08484b	CBG08484b		[unknown]
CDS:CBG08484a	CBG08484a		[unknown]

0 RNAi Result

16 Allele

• WBVar00113627
• WBVar00113626
• WBVar00113628
• WBVar00053014
• WBVar00053019
• WBVar00053024
• WBVar00021274
• WBVar00021309
• WBVar00021279
• WBVar00021314
• WBVar00021284
• WBVar00021319
• WBVar00021289
• WBVar00021294
• WBVar00021299
• WBVar00021304

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1070136
• Remark: Cbr-grh-1, AGCGTTGCGCGAAAGGGATAACCGTAAAAGTGGATGACGAAATGCTCCGTTTGTATTGCA, WBGene00030266
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term